If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Corresponding author at: Ming Wu, PhD, MD, Department of Thoracic Surgery, 2nd Affiliated Hospital, School of Medicine, Zhejiang University, 88 JieFang Rd, Hangzhou 310009, China
Department of Thoracic Surgery, 2nd Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310009, ChinaKey Laboratory of The Diagnosis and Treatment of Severe Trauma and Burn of Zhejiang Province, Hangzhou, Zhejiang 310009, China
Ischemia-reperfusion injury (IRI), which involves severe inflammation and edema, is an inevitable feature of the lung transplantation process and leads to primary graft dysfunction (PGD). The activation of aquaporin 1 (AQP1) modulates fluid transport in the alveolar space. The current study investigated the role of AQP1 in ischemia-reperfusion (IR)-induced lung injury.
Methods
A mouse model of lung IR was established by clamping the left lung hilar for 1 h and released for reperfusion for 24 h. The AQP1 inhibitor acetazolamide (AZA) was administered 3 days before lung ischemia with a dose of 100 mg/kg per day via gavage. Lung injury was evaluated using the ratio of wet-to-dry weight, peripheral bronchial epithelial thickness, degree of angioedema, acute lung injury score, neutrophil infiltration, and cytokine concentrations in bronchoalveolar lavage fluid.
Results
Compared with sham treatment, ischemia with no reperfusion (IR 0h) and ischemia with reperfusion for 24 h (IR 24 h) significantly upregulated AQP1 expression, increased the wet/dry weight ratio, angioedema, neutrophil infiltration and cytokine production (interleukin -6 and tumor necrosis factor -α) and thickened the peripheral bronchial epithelium. AZA exacerbated inflammation and pulmonary edema.
Conclusion
AQP1 may exert a protective effect against IR-induced lung injury, which could be attributed to alleviating pulmonary edema and inflammation. AQP1 upregulation might be a potential application to alleviate lung IRI and decrease the incidence of PGD.
Pathological characteristics of IR and PGD mainly include neutrophil activation, release of pro-inflammatory cytokines, endothelial cell dysfunction, and disruption of the endothelial barrier, resulting in pulmonary edema and impaired pulmonary function.
Currently, there are no therapeutic agents clinically utilized to specifically prevent PGD. Thus, better understanding the mechanisms of lung ischemia-reperfusion injury (IRI) is paramount for the treatment of PGD.
Aquaporins (AQPs) are small, hydrophobic, integral membrane proteins that mediate water transport across the membranes in various systems.
The change of AQPs expression is associated with development of IR induced inflammation and edema in multiple organs, including brain, kidneys, retinal and testis tissues.
AQP1 is abundantly expressed in endothelial cells surrounding terminal bronchiole and alveolus and is the dominating route for water transition across the pulmonary microvascular endothelium.
However, the role of AQP1 during lung IR was disputable, as studies have shown that AQP1 expression is upregulated or decreased in various IR lung injury models.
Therefore, we hypothesis that AQP1 plays a role in the development of edema and inflammation during lung IRI. We are hoping to develop a new target for the improvement of PGD after lung transplant.
Methods
Animals
The animal experiment was approved by the Ethics Committee of the Second Affiliated Hospital School of Medicine, Zhejiang University (2021-003) and performed in compliance with the approved guidelines. Male C57/BL6 mice (8–12 weeks old; 25–28 g; n=60) were purchased from China Shanghai Lingchang Biological Technology Co., Ltd. and housed at the specific pathogen free level laboratory animal center at Zhejiang University (26–28 °C; 55% humidity; 10-h light/14-h dark cycle).
Construction of lung ischemia-reperfusion injury animal model
An in vivo model of lung IR was established via occlusion of the left lung hilum as reported.
Briefly, the mice were anesthetized by intraperitoneal injection of pentobarbital sodium (P3761, Sigma-Aldrich, Germany) at a dose of 80 mg/kg, then mechanically ventilated with room air at a rate of 130 breaths/min, a tidal volume of 0.35 ml. An anterolateral thoracotomy was performed through the 4th intercostal space. The left hilum was exposed and clamped with microvascular clamps for 1 h. The time point when the clamp was loosened was defined as reperfusion for 0h in mice. In the ischemia group, the mice were exposure to ischemia for 1 h and reperfusion for 0 h. And in the IR group, the mice were exposure to ischemia for 1 h and reperfusion for 24 h. The thoracic cavity was closed, anesthesia was reduced, and the mice were extubated (Fig. 1). Mice in the sham group underwent the same surgery without hilum occlusion.
Fig. 1Construction of ischemia/reperfusion (IR) model.
Acetazolamide (AZA, A194116, Shanghai Aladdin Biochemical Technology Co., Ltd., Shanghai, China), a sulfanilamide that acts as a carbonic anhydrase inhibitor, has been shown to have a direct inhibitory effect on AQP1 expression.
AZA was administered via gavage three days before the operation at a dose of 100 mg/kg per day.
Bronchoalveolar lavage and cytokine analysis
Left lungs were lavaged with 1 ml of ice cold saline. The bronchoalveolar lavage fluid (BALF) was centrifuged at 4 °C (1500 revolutions per minute, 10 min). The supernatant was transferred to a new tube and stored at −80 °C. The levels of necrosis factor alpha (TNFα) and interleukin 6 (IL-6) in the BALF were measured using commercial enzyme-linked immuno sorbent assay (ELISA) kit according to the manufacturer's instructions. Mouse IL-6 and TNFα ELISA kits (EK0411, EK0527) were purchased from Boster Biological Technology Co. Ltd. Wuhan, China.
Lung wet-to-dry weight ratio
The middle portion of the left lung of mouse was harvested and weighed before and after drying for 72 h at 55 °C in an oven until a stable weight was obtained. The ratio of wet-to-dry weight reflected lung water accumulation after lung injury.
Hematoxylin-eosin staining
The lower portion of the left lung was harvested, inflated, fixed in 4% neutral buffered formaldehyde, and embedded in paraffin. The continuous sections were prepared, and the thickness of each section was 3 μm. The sections were deparaffinized and hydrated with gradient alcohol (100%, 90%, 80% and 70%) for 5 min each time. After hydration, the sections were stained with hematoxylin for 5 min and differentiated with 75% ethanol containing 1% hydrochloric acid and treated with 1% ammonia solution for seconds thereafter. Subsequently, the sections were stained with eosin for 5 min, and dehydrated with gradient alcohol (95% alcohol for 15 min, 100% alcohol for 10 min twice, Xylol for 10 min twice). Finally, the section was mounted with Permount TM Mounting Medium (10004160, Sinopharm Chemical Reagent Co., Ltd. Shanghai, China). Histological changes in the lung were observed and photographed under a microscope (BX51, Olympus, Japan) in a blinded manner.
Immunohistochemistry
The specimens were fixed with 4% neutral buffered formaldehyde and embedded in paraffin, and 3 μm continuous sections were prepared, dewaxed and dried. These sections were processed for antigen retrieval by treatment with hot Tris-ethylenediaminetetraacetic acid (EDTA) for 5–10 min and cooled at room temperature (RT). Then, the sections were incubated with primary antibodies against myeloperoxidase (MPO) (ab188211; abcam, England) at a dilution of 1:100 in phosphate-buffered saline (PBS) at 4 °C overnight. Signals were detected using an avidin-biotin-peroxidase complex in combination with diaminobenzidine (DAB) substrate (horseradish peroxidase-conjugated second antibody and DAB kit, K5007, DAKO, Glostrup, Denmark). Finally, the sections were rinsed with distilled water, counterstained with hematoxylin, examined and photographed under a microscope (BX51, Olympus, Japan).
Peripheral bronchial epithelial thickness and angioedema measurement
Hematoxylin-eosin-stained lung tissue slices were observed and photographed under a microscope (BX51, Olympus, Japan). Those with a clear view of a monolayer of bronchial epithelial cells were measured for epithelial thickness. The perivascular cuff area and vessel area were measured to calculate the index of perivascular cuff area to the vessel area to indicate the degree of angioedema.
The severity of each of these pathological features was evaluated. Three observers, who were blinded to the various treatment groups, scored and calculated the acute lung injury score on obtained images. At least three fields of one slide/one mouse were evaluated. Six mice in one group were evaluated. Indicators include: (A) neutrophil infiltration in the alveoli space (none = score 0, 1–5 = score 1, > 5 = score 2); (B) neutrophils in the interstitial space (none = score 0, 1–5 = score 1, > 5 = score 2); (C) hyaline membranes (none = score 0, 1 = score 1, > 1 = score 2); (D) tissue fragments in the airway (none = score 0, 1 = score 1, > 1 = score 2), and (E) alveolar septal thickness (< 2x = score 0, 2x − 4x = score 1, > 4x = score 2). Acute lung injury score algorithm: ([(20 × A) + (14 × B) + (7 × C) + (7 × D) + (2 × E)]/number of fields × 100).
Western blot analysis
Western blotting was performed as described in a previous study.
Lung tissues were shredded with scissors and homogenized using a homogenizer (TP100253, Jieling Instrument Manufacturing (Tianjin) Co., Ltd., China), and then lysed in RIPA (P0013B, Beyotime Company, China) lysis buffer for 30 min on ice. A bicinchoninic acid assay (BCA) protein quantitation kit (P0009, Beyotime Company, China) was used for protein quantitation. Protein samples were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto a polyvinylidene fluoride membrane (IPVH00010, Merck Millipore, Temecula, CA, USA). The membranes were blocked with 5% bovine serum albumin (BSA) and probed with primary antibodies against AQP1 (sc-25287, 1:200, Santa Cruz, USA), AQP4 (sc-32739, 1:600, Santa Cruz, USA) and tubulin (11224-1-AP, 1:5000, Proteintech Group, Inc. Chicago, USA) and HRP-conjugated anti-Mouse IgG secondary antibodies (7076S, 1:10000, Cell Signaling Technology, USA), horseradish peroxidase (HRP)- conjugated anti-Rabbit IgG secondary antibodies (111-035-003, 1:10000, Jackson, USA), and HRP- conjugated anti-Goat IgG secondary antibodies (705-035-003, 1:10000, Jackson, USA). Immunoreactive bands were detected using an efficient chemiluminescence-prime kit and quantified with software (Image Lab 6.1, Bio-Rad Laboratories, Inc., 1000 Alfred Nobel Drive Hercules, California 94547 USA).
Total RNA was isolated using TRIzol reagent (9109, Takara, Japan) according to the manufacturer's protocol. cDNA was synthesized using a reverse transcriptase kit (AG11706, Accurate Biology, Hunan China), and SYBR Green PCR Master Mix (AG11701, Accurate Biology, Hunan China) was used to measure the mRNA levels. β-actin was used as the internal reference. Relative expression was calculated using the 2−ΔΔCT method.
The following primer sequences were used: β-actin, forward: 5ʹ-TCCTTCTTGGGTATGGAA and reverse: 5ʹ-AGGAGGAGCAATGATCTTGATCTT; AQP1, forward: 5ʹ AGGCTTCAATTACCCACTGGA and reverse: 5ʹ- GTGAGCACCGCTGATGTGA. (Sangon Biotech (Shanghai) Co., Ltd, China)
Statistical analysis
All values were reported as mean ± standard deviation (SD) or median (Minimum-maximum), as appropriate. Comparisons between two groups were analyzed using the unpaired t-test, and comparisons among multiple groups were analyzed using one-way ANOVA and Newman-Keuls multiple comparisons test. A value of P < 0.05 was statistically significant. All statistical analyses were performed using GraphPad Prism software (V8.3.1, GraphPad Software, San Diego, CA).
Results
Upregulation of AQP1 protein expression after lung ischemia reperfusion
The left lung hilar was clamped for 1 h and then released to introduce lung IR. The protein expression level of AQP1 in the mouse lung were detected using western blotting (Fig. 2) and the mRNA level was determined by real-time PCR (Fig. 3). The mRNA level of AQP1 showed almost no change during IR. However, we found that after the treatment of lung ischemia for 1 h, AQP1 protein expression was significantly increased to 2-fold of sham (n=6, ⁎⁎p < 0.01, R 0h + Vehicle vs Sham + Vehicle), and further increased to 4-fold of sham when reperfusion for 1 day was performed (n=6, ⁎⁎⁎p < 0.001, R 1d + Vehicle vs Sham + Vehicle). The AQP1 inhibitor AZA (100 mg/kg per day) significantly decreased ischemia-induced upregulation of AQP1 protein expression (n=6, $p < 0.05, R 0h + AZA vs R 0h + Vehicle), and also decreased IR induced upregulation of AQP1 expression to 3-fold of sham (n=6, $p < 0.05, R 1d + AZA vs R 1d + Vehicle) (Fig. 2 A and B). The expression of AQP4 in the lung was not changed significantly by IR or AZA (n=6, p>0.05) (Fig. 4).
Fig. 2AQP1 protein expression increased after the treatment of lung ischemia reperfusion in mice. Left lung hilar was clamped for 1 h and released to induce ischemia reperfusion injury. (A) The protein expression level of AQP1 detected using western blotting. (B) Densitometry of AQP1 signal. Tubulin was an internal control. Mean ± SD, n=6, ⁎⁎p < 0.01, ⁎⁎⁎p < 0.001 compared with Sham + Vehicle, ##p < 0.05, compared with R 0h + Vehicle, $p < 0.05, compared with corresponding Vehicle; One-way ANOVA and Newman-Keuls multiple comparisons test.
Fig. 3Almost no change of AQP1 mRNA levels was detected during lung ischemia reperfusion in mice. The mRNA level of AQP1 detected by qPCR. The β-actin was an internal control. Mean ± SD, n=6, *p < 0.05, compared with Sham + AZA.
Fig. 4No changes of AQP4 protein expression were detected during lung ischemia reperfusion in mice. (A) The protein expression level of AQP4 in lung detected using western blotting. (B) Densitometry of AQP4 signal. Tubulin was an internal control. Mean ± SD, n=6. No statistical significante difference was found among groups (p > 0.05).
HE staining of lung sections revealed that mice that suffered lung ischemia for 1 h developed alveolar interstitial edema (Fig. 5A). Increased terminal bronchial epithelial thickness and hyaline membranes in part of the alveolar cavity were observed in reperfusion for 0h and for 1 day (Fig. 5A). Compared with sham, both ischemia and IR induced significant increment of epithelial thickness (Fig. 5B, ⁎⁎⁎p < 0.001, R 0h + Vehicle, R 1d + Vehicle, vs Sham + Vehicle) and significant increment of perivascular cuff area (Fig. 5C, ⁎⁎⁎p < 0.001, R 0h + Vehicle, R 1d + Vehicle, vs Sham + Vehicle), as well as the wet-to-dry weight of lung tissue (Fig. 5D, n=6, ⁎⁎⁎p < 0.001, R 0h + Vehicle, R 1d + Vehicle, vs Sham + Vehicle), which reflected interstitial edema. AZA increased pulmonary edema further in the lung IR (R 1d) groups (&p < 0.05, R 1d + AZA vs R 1d + Vehicle), but AZA had no effect on the sham group (Fig. 5).
Fig. 5AQP1 inhibition exacerbates ischemia reperfusion -induced edema. (A) Representative image of HE staining of lung section. Bar=200 μm. (B) The epithelial thickness was measured. (C) Relative perivascular cuff area was determined. (D) Lung wet-to-dry ratio was detected. Mean ± SD, n=6, ⁎⁎⁎p < 0.001, compared with Sham + Vehicle, ##p < 0.01, ###p < 0.001, compared with R 0h + Vehicle, &p < 0.05, compared with R 1d + Vehicle; One-way ANOVA and Newman-Keuls multiple comparisons test.
therefore we evaluated neutrophil infiltration in lung tissue using immunochemical staining of MPO. We found that the number of MPO-positive cells increased dramatically in lung IR (⁎⁎⁎p < 0.001, R 0h + Vehicle, R 1d + Vehicle, vs Sham + Vehicle) (Fig. 6 A and B). Treatment with AZA significantly increased MPO-positive cell infiltration in ischemia for 1 h and reperfusion for 1 d (n=6, &&&p < 0.001, R 1d + AZA vs R 1d + Vehicle group) but did not affect the sham group or ischemia for 1 h (Fig. 6 A and B).
Fig. 6AQP1 inhibition exacerbates neutrophil infiltration and cytokine releasing induced by lung ischemia reperfusion. (A) Immunohistochemistry for Myeloperoxidase (MPO) in the lung. n=6. (B) The number of neutrophils (MPO-positive cells) was counted in 3 fields of one mouse lung section. n=6. (C) TNFα and (D) IL-6 in BALF. n=4. Mean ± SD, *p < 0.05, ⁎⁎p < 0.01, ⁎⁎⁎p < 0.001, compared with Sham + Vehicle, ##p < 0.01, compared with R 0h + Vehicle, &p < 0.05, &&&p < 0.001, compared with R 1d + Vehicle; One-way ANOVA and unpaired t-test.
AQP1 inhibition increases ischemia reperfusion-induced cytokine production
Furthermore, we found that compared with that in the sham group, TNFα in BALF was significantly increased in the ischemia for 1 h without reperfusion group (n=4, *p < 0.05, R 0 h + Vehicle vs Sham + Vehicle) and further increased in the reperfusion for 1 day group (⁎⁎⁎p < 0.001, R 1d + Vehicle vs Sham + Vehicle). AZA administration induced a tendency of further increase of TNFα level in BALF (Fig. 6 C). The changes of IL-6 level in BALF was similar with that of TNFα, and further increased by AZA (Fig. 6D). (n=4, &p < 0.05, R 1d + AZA vs R 1d + Vehicle).
AQP1 inhibition exacerbates lung tissue damage induced by ischemia reperfusion
Finally, the lung injury score was evaluated using an algorithm which was reported previously.
Among the vehicle groups, the ischemia for one hour with reperfusion for one day group had the highest score, followed by the ischemia without reperfusion group (n=6, ⁎⁎⁎p < 0.001, vs Sham + Vehicle). The lung injury scores increased when AQP1 was inhibited by AZA in lung ischemia and ischemia-reperfusion groups (n=6, &p < 0.05, R 1d + AZA vs R 1d + Vehicle group) (Fig. 7).
Fig. 7AQP1 inhibition exacerbates lung tissue damage induced by ischemia reperfusion. The lung injury score was evaluated using an algorithm reported previously. Mean ± SD, n=6, ⁎⁎⁎p < 0.001, compared with Sham + Vehicle, &p < 0.05, compared with R 1d + Vehicle; One-way ANOVA and Newman-Keuls multiple comparisons test.
This study demonstrates that AQP1 inhibition by AZA aggravates lung IRI in mice. Our results further supported the previous report in AQP1 knock-out model, where lung IR injury was enhanced in AQP1 null mice with significantly enhanced leukocyte infiltration, and microvascular permeability.
We found that IR significantly elevated AQP1 expression levels, increased the wet-to-dry weight ratio, and thickened the terminal bronchiolar epithelium and perivascular cuff area/vascular area. Inhibiting AQP1 with AZA further worsened pulmonary edema. AQP1 plays an important role in the liquid exchange between alveoli and capillaries.
Using the string database, we examined AQP1 interacting proteins and determined the important role of AQP1 in water-salt balance. Previous researchers showed that fluid movement was reduced 10-fold by the deletion of AQP1.
Effects of different resuscitation fluids on pulmonary expression of aquaporin1 and aquaporin5 in a rat model of uncontrolled hemorrhagic shock and infection.
supported the results we showed here, indicating that the increase in AQP1 expression is involved in alleviating pulmonary edema.
In our study, elevated AQP1 expression was accompanied by increased neutrophil infiltration after IR. After AZA treatment, the expression of AQP1 decreased, and was accompanied with further increased neutrophil infiltration, which verified the inhibition of AQP1 exacerbating inflammation in LIRI. Increased neutrophil recruitment and inflammatory cytokines are responsible for the initiation and maintenance of lung injury in IR-induced PGD.
Similar to our results, previous study showed that in leucocytes of septic patients, AQP1 expression was induced at disease onset and further increased 3-fold.
Amelioration of airway inflammation and pulmonary edema by Teucrium stocksianum via attenuation of pro-inflammatory cytokines and up-regulation of AQP1 and AQP5.
Our results further showed that the expression of AQP1 correlated with the levels of IL-6 and TNF-α in BALF during LIRI, that is AQP1 inhibition further increased IR-induced increase of IL-6 and TNF-α in BALF. Chemokines, including TNF-α and IL-6, play essential roles in the development of lung IRI and correlate with the severity of PGD following transplantation.
We found both ischemia and ischemia-reperfusion increased AQP1 protein expression. AZA reversed ischemia-induced increase of AQP1 protein level to sham level, but only reversed IR-induced increment a little bit that is still higher than sham level. Intriguingly, AQP1 mRNA expression was not significantly affected by IR or AZA. We speculated that the inconsistency might rise from the elevated AQP1 expression caused by lung IR
In addition to attenuating AQP1 expression, there might be other potential mechanisms by which AZA is involved in lung IR. AZA participates in reducing ischemic cerebral edema by inhibiting the expression of AQP4 mRNA,
We found that AZA decreased the expression of AQP1, whereas AZA did not affect the expression of AQP4. As thus, during LIRI, AZA aggravates inflammation by inhibiting the expression of AQP1, but not by affecting AQP1-mediated water conduction. In addition, the homeostasis of lung function could be regulated by kidney.
Thus, AZA may participate in lung IR injury through regulating renal AQP1. Further studies are needed to address this interesting issue.
This study has limitations. The model of left lung hilum occlusion may not be fully representative of lung transplantation, though studies have shown that the hilar ligation model can simulate PGD in vivo.
To strengthen our findings, further controls and the use of AQP1 knock-out models can be considered.
Conclusions
In conclusion, we demonstrated that pre-treatment with acetazolamide aggravated experimental lung IR injury, and this effect is associated with a relatively attenuated induction of AQP1 expression, which indicated that AQP1 plays a key role in lung edema and the inflammatory response following lung IR. Our study confirmed the protective role of AQP1 in IRI and revealed new potential strategies to reduce IRI in clinical lung transplantation.
Authors Contributions
Wu Ming and Wang Qi conceived and designed the analysis. Li Yangfan; Wang Tong; Wu Chuanqiang collected data and analysis. Wang Qi; Wu Chuanqiang; Li Yangfan wrote the paper.
Funding
This work was supported by the Zhejiang Provincial Natural Science Foundation (LQ17H010002, LZ20H010001) and Zhejiang Provincial Department of Education (Y201635465).
Conflicts of Interest
None.
Acknowledgments
Thanks to Lu Yunbi for assistance with experiments and to Zhang Weiping for valuable discussion.
Appendix. SUPPLEMENTARY MATERIALS Our supplementary matrial is the cover letter, we are not sure if it is suitable to upload here.
Effects of different resuscitation fluids on pulmonary expression of aquaporin1 and aquaporin5 in a rat model of uncontrolled hemorrhagic shock and infection.
Amelioration of airway inflammation and pulmonary edema by Teucrium stocksianum via attenuation of pro-inflammatory cytokines and up-regulation of AQP1 and AQP5.
00374-3&id=gr1.jpg){kind=link}
00374-3&id=gr2.jpg){kind=link}
00374-3&id=gr3.jpg){kind=link}
00374-3&id=gr4.jpg){kind=link}
00374-3&id=gr5.jpg){kind=link}
00374-3&id=gr6.jpg){kind=link}
00374-3&id=gr7.jpg){kind=link}