Advertisement

Effect of the HMG-CoA Reductase Inhibitor Rosuvastatin on Early Chronic Kidney Injury in Obese Zucker Rats Fed With an Atherogenic Diet

      Abstract

      The obese Zucker rat (OZR) spontaneously develops hyperlipidemia, insulin resistance, and microalbuminuria. In this study, the initial metabolic, functional, and glomerular pathology in young OZR fed with an atherogenic diet resembles the characteristics of metabolic syndrome. Hyperlipidemia and other metabolic derangement cause early glomerular damage in OZR by 10 weeks of age, before overt diabetes is developed. Consequently, the effects of potential interventions should also be evaluated at the young age. In OZR fed with an atherogenic high-fat diet, low (5 mg/kg) and high (20 mg/kg) dosages of rosuvastatin started at 5 weeks and maintained for 10 weeks induced a significant improvement in metabolic abnormalities, blood pressure, and renal function, including microalbuminuria. The low dose of rosuvastatin significantly decreased mesangial expansion, and the high dose exerted a marked protective effect on the development of both glomerular hypertrophy and mesangial expansion. The statin also attenuated the inflammatory expression in the kidney cortex.

      Key Indexing Terms

      The physiologic derangements that cause affected patients to have an increased risk for developing diabetes and cardiovascular and renal diseases is termed metabolic syndrome (MS).
      • Reisin E.
      • Alpert M.A.
      Definition of the metabolic syndrome: current proposals and controversies.
      Obese Zucker rats (OZR) have a defective leptin receptor and spontaneously develop hyperlipidemia, insulin resistance, obesity, and microalbuminuria.
      • Iida M.
      • Murakami T.
      • Ishida K.
      • et al.
      Substitution at codon 269 (glutamine –> proline) of the leptin receptor (OB-R) cDNA is the only mutation found in the Zucker fatty (fa/fa) rat.
      • Kasiske B.L.
      • O’Donnell M.P.
      • Keane W.F.
      The Zucker rat model of obesity, insulin resistance, hyperlipidemia, and renal injury.
      The initial metabolic, functional, and glomerular pathology in the young OZR resembles the characteristics of MS.
      • Kasiske B.L.
      • O’Donnell M.P.
      • Keane W.F.
      The Zucker rat model of obesity, insulin resistance, hyperlipidemia, and renal injury.
      • Coimbra T.M.
      • Janssen U.
      • Grone H.J.
      • et al.
      Early events leading to renal injury in obese Zucker (fatty) rats with type II diabetes.
      The dyslipidemic pattern in OZR, like in other rodent models, has more high-density lipoprotein (HDL) than low-density lipoprotein (LDL) cholesterol. In the current experiment, however, the intake of saturated fats and cholesterol was increased when the OZR were 5 weeks old. The previously described dietetic changes induced increased levels of LDL and decreased levels of HDL cholesterol. Consequently, this OZR model shows dyslipidemic alterations that better characterize the changes that occur in humans with MS.
      • Vaskonen T.
      • Mervaala E.
      • Krogerus L.
      • et al.
      Supplementation of plant sterols and minerals benefits obese Zucker rats fed an atherogenic diet.
      In MS, lipotoxicity and the consequent high circulating levels of free fatty acid (FFA) are associated with the progression of organ damage. In the kidney, the mesangial cells, in the presence of intraglomerular hypertension and hyperfiltration, are also at risk for exposure to the circulating FFA.
      • Kasiske B.L.
      • O’Donnell M.P.
      • Keane W.F.
      The Zucker rat model of obesity, insulin resistance, hyperlipidemia, and renal injury.
      • Richards R.J.
      • Porter J.R.
      • Inserra F.
      • et al.
      Effects of dehydroepiandrosterone and quinapril on nephropathy in obese Zucker rats.
      Lipid reduction by different interventions may be beneficial to improve the metabolic and pathologic damage of MS,
      • Richards R.J.
      • Porter J.R.
      • Inserra F.
      • et al.
      Effects of dehydroepiandrosterone and quinapril on nephropathy in obese Zucker rats.
      • O’Donnell M.P.
      • Kasiske B.L.
      • Kim Y.
      • et al.
      Lovastatin retards the progression of established glomerular disease in obese Zucker rats.
      and the use of statins have proven to be beneficial in old OZR
      • Kasiske B.L.
      • Cleary M.P.
      • O’Donnell M.P.
      • et al.
      Effects of genetic obesity on renal structure and function in the Zucker rat.
      with developed diabetes mellitus and diabetic nephropathy.
      Because hyperlipidemia causes glomerular damage in OZR by 10 weeks of age,
      • Kasiske B.L.
      • Cleary M.P.
      • O’Donnell M.P.
      • et al.
      Effects of genetic obesity on renal structure and function in the Zucker rat.
      potential interventions should be evaluated before overt diabetes is developed and when the animals share the characteristics of MS.
      The current study postulates that the HMG-CoA reductase inhibitor rosuvastatin will induce an early reduction of hyperlipidemia and other metabolic characteristics of the young OZR fed with high-fat diets. These changes will improve the metabolic abnormalities of OZR and delay the initial glomerular damage present in the young animals.

      METHODS

      Animals

      Heterozygous (fa/+) lean (LZR) and homozygous (fa-fa) OZR were purchased from Harlan when they were 4 weeks of age and were housed in individual, hanging wire-mesh metabolic cages with a temperature- and humidity-controlled environment that provided a daily 12-hour light –dark schedule. The animals had free access to water. The control animals were fed with a meal of ground pellets (5001 rodent diet; LabDiet, Richmond, IN,) or high-fat diets (modified AIN-936; Dyets, Bethlehem, PA) that provided 5.09 kcal/g with 35% of fat-, 15% of protein-, and 50% of carbohydrate-derived calories. The HMG-CoA reductase inhibitor rosuvastatin, supplied by Astra Zeneca LP, Wilmington, DE, was premixed by Dyets to the diet of the rats for the 10 weeks of treatment. The treated OZR received either 5 mg/kg (low dose) or 20 mg/kg (high dose) of rosuvastatin, and the lean Zucker rats (LZR) received 20 mg/kg (high dose).
      The daily caloric intake varies with age
      • Vasselli J.R.
      Patterns of hyperphagia in the Zucker obese rat: a role for fat cell size and number?.
      ; the animals find fat to be extremely palatable and so will consume significantly more for a period of time, and at the time they are growing, they alter their food intake. Subsequently, the animals steadily lowered their food intake relative to body weight (BW). As a result, the dose of rosuvastatin consumed on a daily basis varied as well. Based on our experience with OZR consuming powdered chow and extrapolating these data to a high-fat diet, estimated daily dosing can be calculated for both the low- and high-dose groups. It is assumed that the rats’ daily caloric intake would be the same on the high-fat diet as on powdered chow. The low-dose group had 80 mg of rosuvastatin added per kilogram diet. The high-dose group had 150 mg rosuvastatin added to 1 kg of diet, and the estimated dose of rosuvastatin was 5 and 20 mg/kg in the tested animals.
      The rats were divided into 7 groups, consisting of 8 rats each, and were subjected to the following treatment:
      • Group I: lean control, LZR-control.
      • Group II: LZR, high-fat diet (LZR-HF).
      • Group III: LZR, high-fat diet, high dose of rosuvastatin (LZR-HF-HR).
      • Group IV: OZR, regular diet (OZR-RD).
      • Group V: OZR, high-fat diet (OZR-HF).
      • Group VI: OZR, high-fat diet and rosuvastatin high dose (20 mg/kg) (OZR-HF-HR).
      • Group VII: OZR, high-fat diet and rosuvastatin low dose (5 mg/kg) (OZR-HF-LR).
      Food consumption and BW were determined each week. All the animals were sacrificed at the end of week 15, after 10 weeks of treatment.

      Measurement of BW and Food Intake

      BW, food intake, and survival rate were monitored weekly in each group. For this purpose, each animal was placed individually in a metabolic cage for a 24-hour urine collection at the basal and at the end of the study. After total urinary volume was measured, the urine was aliquoted, frozen (−20°C), and stored until processed for the determination of creatinine.
      All the following measurements were performed at the end of the 10-week treatment protocol.

      Blood Pressure Measurements

      Tail systolic, mean, and diastolic blood pressures were measured at baseline and at weeks 5 and 10 after the treatment, using a Coda 6-NonInvasive Blood Pressure Acquisition System (Kent Scientific, Torrington, CT). Animals were placed in individual holders, and an occlusion cuff and a volume-pressure-recording cuff were placed close to the base of the tail.

      Urinary Albumin Excretion

      Urinary albumin concentration was determined using a conventional direct competitive enzyme-linked immunosorbent assay that recognizes antigen (albumin) in test samples by using Nephrat II Albumin Kit, according to the manufacturer’s protocol (Exocell, Philadelphia, PA).

      Renal Function

      Blood urea nitrogen (BUN) and creatinine were determined using a Stat Profile Critical Care Xpress Analyzer (Nova Biomedical, Waltham, MA), according to the manufacturer’s instructions.

      C-Reactive Protein

      C-reactive protein (CRP) was measured in the plasma of the experimental animals by kit method (Alpco Diagnostics, Salem, NH).

      Total Cholesterol, HDLc, LDLc, and VLDLc

      The plasma total cholesterol, HDLc, and LDLc/VLDLc cholesterol were quantified by kit method (Biovision, Mountain View, CA).

      Triglycerides

      Plasma triglycerides were measured by enzymatic assay, per the manufacturer’s (Sigma-Aldrich) protocol, as described earlier.
      • Alemzadeh R.
      • Fledelius C.
      • Bodvarsdottir T.
      • et al.
      Attenuation of hyperinsulinemia by NN414, a SUR1/Kir6.2 selective K-adenosine triphosphate channel opener, improves glucose tolerance and lipid profile in obese Zucker rats.
      This protocol measures the free glycerol and total triglycerides of blood plasma samples.

      Insulin

      Five microliters of plasma was used to measure insulin concentrations by using Ultra-sensitive Rat Insulin ELISA kit Crystal Chem, IL, as described earlier.
      • Unger R.H.
      Minireview: weapons of lean body mass destruction: the role of ectopic lipids in the metabolic syndrome.
      Plasma assays for the laboratory work were performed by standard automated laboratory techniques.

      Histology

      After ligating the renal artery, the right kidney was removed and used for histologic studies. Each rat was perused through the abdominal aorta with phosphate-buffered saline (0.1 M, pH 7.4) containing 6% sucrose and 500 U heparin/L. The kidneys were excised, decapsulated, and weighed. For light microscopy, longitudinal sections were fixed in 10% buffered formalin embedded in paraffin cut into 2-μm thick sections and then stained with hematoxylin and eosin for histologic analysis and examined under a magnification of 20×. Slides were used to measure glomerular size and dimensions. Forty glomeruli per section were randomly selected and measured by an observer blinded to the phenotype and treatment of each rat to assess the glomerular and mesangial area and perimeter.

      RNA Isolation and Real-Time RT-PCR

      Total RNA was extracted from the kidney cortex of the experimental animals using TriZol reagent (Invitrogen) and reverse transcribed using oligo (dT) and RT. Expression levels of desmin, intercellular adhesion molecule (ICAM)-1, transforming growth factor (TGF)-β, and tumor necrosis factor (TNF)-α mRNA were determined using specific rat primers, shown in Table 1. The linearity of the amplifications as a function of the cycle number was tested in preliminary experiments, and desmin, ICAM-1, TGF-β, and TNF-α mRNA expression was normalized using 18 S as housekeeping gene. Real-time RT-PCR was performed in 384-well PCR plates using Bio-Rad PCR Master Mix (the iTaq SYBR Green Super mix with ROX) and the ABI Prism 7900 sequence detection system (Applied Biosystems). The PCR cycling conditions were as follows: 50°C for 2 minutes, 95°C for 3 minutes, followed by 40 cycles (15 seconds at 95°C, 1 minute at 60°C). A dissociation step (15 seconds at 95°C, 15 seconds at 60°C, and 15 seconds at 95°C) was added to check the melting temperature of the specific PCR product.
      Table 1Sequences of primers used to detect desmin, ICAM-1, TGF-β, and TNF-α by real-time RT-PCR
      Gene namePrimer sequences
      18 SF: agttggtggagcgatttgtc
      R: aacgccacttgtccctctaa
      DesminF: gtgaagatggccttggatgt
      R: gctggtttctcggaagttga
      ICAM-1F: agaatgtctccgaggtcagg
      R: cttcagaggcaggaaacagg
      TGF-βF: tcagacattcgggaagcagt
      R: agacagccactcaggcgtat
      TNF-αF: gtcgtagcaaaccaccaagc
      R: tgtgggtgaggagcacatag
      ICAM, intercellular adhesion molecule; TGF, transforming growth factor; TNF, tumor necrosis factor; RT-PCR, reverse transcriptase polymerase chain reaction.

      Immunofluorescence Detection of Desmin

      Immunofluorescence studies were performed by following the protocol of Khaleduzzaman et al.
      • Khaleduzzaman M.
      • Francis J.
      • Corbin M.E.
      • et al.
      Infection of cardiomyocytes and induction of left ventricle dysfunction by neurovirulent polytropic murine retrovirus.
      For detecting podocyte damage, slides were rehydrated and incubated overnight at 4°C with a 1:100 dilution of Monoclonal Mouse Anti-Human Clone D33 Isotype: IgG1, kappa (Dako, Carpinteria, CA) and covered with a parafilm coverslip. Slides were then incubated with 5 μg/mL of goat anti-Fab2 anti-mouse IgG – BT (Zymed) for 30 minutes at room temperature and then incubated with 4 μg/mL of streptavidin-conjugated Alexa Fluor 594 (Invitrogen) for 30 minutes at room temperature. Slides were counterstained with 100 ng/mL of 4′,6-diamidino-2-phenylindole (Molecular Probes) for 30 minutes, mounted with ProLong Gold Antifade Reagent (Molecular Probes), and allowed to set for at least 2 hours at 4°C. Sections were viewed and imaged under epifluorescence with a Zeiss Axiovert 200 microscope. Images were captured with an Olympus Q Capture 5 camera and Q Capture Pro software [Figures 1 (A)–(G)].
      Figure thumbnail gr1
      Figure 1View of glomeruli in kidney sections from lean and obese Zucker rats. (A) Desmin expression is absent in lean Zucker rats fed with a regular diet. (B) Intense desmin staining was observed in lean Zucker rats fed with a high-fat diet. (C) Desmin expression was prevented by high-dose rosuvastatin (20 mg/kg) treatment. (D) Desmin expression is absent in obese Zucker rats fed with a regular diet. (E) Intense staining of desmin-positive cells was observed in glomeruli of obese Zucker rats fed a high-fat diet. (F) Obese Zucker rats fed a high-fat diet and treated with low-dose rosuvastatin (5 mg/kg) showed a significant decrease in mesangial expansion. (G) Obese Zucker rats fed with a high-fat diet and treated with high-dose rosuvastatin (20 mg/kg) showed a marked protective effect on the development of both glomerular hypertrophy and mesangial expansion and lack of desmin expression (100 μ; 20×).

      Statistical Analysis

      The SAS statistical package (version 9.1.3) was used to analyze the data as a 1-way analysis of variance post hoc pairwise mean. Comparisons of treatment groups to respective controls were conducted with Dunnett’s test, and Tukeys Honestly Significant Differences test was applied to determine the significant differences among the groups. P0.05 was considered significant.

      Statement of Ethics

      All animals were treated humanely under the guidelines of the National Institutes of Health and the Animal Welfare Act. The protocols for this experiment were approved by the Louisiana State University Institutional Animal Care and Use Committee.

      RESULTS

      Effect of Rosuvastatin Treatment on BW, Food Intake, and Blood Pressure

      At the end of 10 weeks of treatment, the BW of the animals that were fed a high-fat diet was significantly higher than that of the age-matched LZR (P<0.05) fed with a regular diet. The final BW among the OZR that had a regular diet (OZR-RD) was lower compared with those that were fed a high-fat diet (OZR-HF) (P<0.05). Rosuvastatin therapy had no effect on the rate of weight gain in obese animals. A similar trend was observed in LZR animals (Table 2).
      Table 2Blood pressure and metabolic characteristics of obese zucker rats and age-matched lean controls at 10 weeks of treatment
      ParametersOZR-RDOZR-HFOZR-HF-LROZR-HF-HRLZR-RDLZR-HFLZR-HF-HR
      Body weight (g)525±2.1604.5±4
      P<0.05 OZR-RD vs. OZR-HF.
      585±5563±6
      P<0.05 OZR-HF vs. OZR-HF-HR.
      374±3407±1382±2.2
      Food intake (g)32±0.318.2±1
      P<0.05 OZR-RD vs. OZR-HF.
      17±0.219±123±0.320±125±1
      SBP (mm Hg)131±3157±0.4
      P<0.05 OZR-RD vs. OZR-HF.
      116±1.3
      P<0.05 OZR-HF vs. OZR-HF-LR.
      124±2
      P<0.05 OZR-HF vs. OZR-HF-HR.
      118±1129±1123±2
      DBP (mm Hg)88±1.2115±0.5
      P<0.05 OZR-RD vs. OZR-HF.
      85±1.4
      P<0.05 OZR-HF vs. OZR-HF-LR.
      78±2.3
      P<0.05 OZR-HF vs. OZR-HF-HR.
      83±1.0793±0.882±0.8
      Insulin (IU/mg)0.47±0.022.25±0.08
      P<0.05 OZR-RD vs. OZR-HF.
      0.76±0.02
      P<0.05 OZR-HF vs. OZR-HF-LR.
      0.66±0.004
      P<0.05 OZR-HF vs. OZR-HF-LR.
      ,
      P<0.05 OZR-HF-LR vs. OZR-HF-HR.
      0.05±0.0010.25±0.01
      P<0.05 LZR-RD vs. LZR-HF.
      0.14±0.004
      P<0.05 LZR-RD vs. LZR-HR.
      Triglycerides (mg/dL)226±3.6977.4±6.4
      P<0.05 OZR-RD vs. OZR-HF.
      102.1±3
      P<0.05 OZR-HF vs. OZR-HF-LR.
      68.4±1.54
      P<0.05 OZR-HF vs. OZR-HF-HR.
      ,
      P<0.05 OZR-HF-LR vs. OZR-HF-HR.
      133.3±0.64182.4±1.46
      P<0.05 LZR-RD vs. LZR-HF.
      59.13±0.76
      P<0.05 LZR-RD vs. LZR-HR.
      Cholesterol (mg/dL)60.24±1.4174.7±0.40
      P<0.05 OZR-RD vs. OZR-HF.
      87.2±0.04
      P<0.05 OZR-HF vs. OZR-HF-LR.
      41.75±0.63
      P<0.05 OZR-HF vs. OZR-HF-HR.
      ,
      P<0.05 OZR-HF-LR vs. OZR-HF-HR.
      22.9±0.6030.57±0.61
      P<0.05 LZR-RD vs. LZR-HF.
      31.60±0.46
      P<0.05 LZR-RD vs. LZR-HR.
      HDLc (mg/dL)16.9±0.4210.6±0.18
      P<0.05 OZR-RD vs. OZR-HF.
      17.3±0.1
      P<0.05 OZR-HF vs. OZR-HF-LR.
      41.50±0.52
      P<0.05 OZR-HF vs. OZR-HF-HR.
      ,
      P<0.05 OZR-HF-LR vs. OZR-HF-HR.
      10.31±0.075.39±0.10
      P<0.05 OZR-HF vs. OZR-HF-LR.
      15.43±0.22
      P<0.05 LZR-RD vs. LZR-HR.
      LDLc (mg/dL)7.7±0.2011.6±0.40
      P<0.05 OZR-RD vs. OZR-HF.
      8.1±0.23
      P<0.05 OZR-HF vs. OZR-HF-LR.
      7.29±0.24
      P<0.05 OZR-HF vs. OZR-HF-HR.
      ,
      P<0.05 OZR-HF-LR vs. OZR-HF-HR.
      5.83±0.079.71±0.16
      P<0.05 LZR-RD vs. LZR-HF.
      2.75±0.05
      P<0.05 LZR-RD vs. LZR-HR.
      BUN (mg/dL)20±0.652±0.6
      P<0.05 OZR-RD vs. OZR-HF.
      22±0.8
      P<0.05 OZR-HF vs. OZR-HF-LR.
      24±0.8
      P<0.05 OZR-HF vs. OZR-HF-LR.
      13±0.1317±0.08
      P<0.05 LZR-RD vs. LZR-HF.
      15±0.03
      P<0.05 LZR-RD vs. LZR-HR.
      Creatinine (mg/dL)0.51±0.021.1±0.001
      P<0.05 OZR-RD vs. OZR-HF.
      0.63±0.01
      P<0.05 OZR-HF vs. OZR-HF-LR.
      0.66±0.01
      P<0.05 OZR-HF vs. OZR-HF-HR.
      0.41±0.010.49±0.01
      P<0.05 LZR-RD vs. LZR-HF.
      0.47±0.01
      P<0.05 LZR-RD vs. LZR-HR.
      Data are expressed as mean±SEM.
      OZR, obese Zucker rat; LZR, lean Zucker rat; SBP, systolic blood pressure; DBP, diastolic blood pressure; HDL, high-density lipoprotein; LDL, low-density lipoprotein; BUN, blood urea nitrogen.
      a P<0.05 OZR-RD vs. OZR-HF.
      b P<0.05 OZR-HF vs. OZR-HF-HR.
      c P<0.05 OZR-HF vs. OZR-HF-LR.
      d P<0.05 OZR-HF-LR vs. OZR-HF-HR.
      e P<0.05 LZR-RD vs. LZR-HF.
      f P<0.05 LZR-RD vs. LZR-HR.
      When food intake was measured during the treatment period, OZR-RD group animals consumed larger amounts of food than all the other groups (P<0.05). The LZR-RD group animals did not show any significant change in food consumption compared with LZR-HF. Rosuvastatin therapy had no effect on food intake (Table 2).
      The systolic blood pressure (SBP) of OZR fed with a high-fat diet (OZR-HF) was significantly higher (P<0.05) compared with those fed with a regular diet (OZR-RD). However, the SBP restored to normal in the rosuvastatin therapy group (OZR-HF-LR and OZR-HF-HR). A similar trend was observed in the diastolic blood pressure (DBP) of the experimental animals. There was no significant change (P<0.05) in the SBP and DBP in LZR treated with a regular diet, high-fat diet, and high-fat diet along with high-dose rosuvastatin treatment (Table 2). We used tail-cuff measurement in this study, which is less preferred than telemetry; however, our results mirror those of a recent telemetry study conducted on OZR, where blood pressure started rising from 10 to 11 weeks and remained elevated until 17 weeks (study end).
      • Osmond J.M.
      • Mintz J.D.
      • Dalton B.
      • et al.
      Obesity increases blood pressure, cerebral vascular remodeling, and severity of stroke in the Zucker rat.

      Effect of Rosuvastatin Treatment on Metabolic Data

      Plasma Insulin Levels and Lipid Profile

      Plasma insulin levels in OZR-HF group increased by 4.8-fold compared with the OZR-RD group (2.25±0.08 and 0.47±0.02 IU/mg, respectively) (P<0.05). Rosuvastatin therapy improved insulin metabolism and attenuated insulin levels in the OZR-LR and OZR-HR groups by 3- and 3.3-fold (0.76±0.02 and 0.66±0.004 IU/mg, respectively) (P<0.05). LZR treated with a HF diet showed a 5-fold increase in insulin levels, and high-dose rosuvastatin therapy ameliorated the insulin level significantly (0.25±0.01 and 0.14±0.004 IU/mg, respectively, P<0.05) (Table 2).

      Lipid Metabolism

      OZR-HF animals showed a significant increase in plasma triglyceride levels compared with the OZR-RD group (977.4±6.4 mg/dL versus 226±3.6 mg/dL, P<0.05). Interestingly, the OZR-HF-LR and OZR-HF-HR groups exhibited a significant (P<0.05) reduction in plasma triglyceride levels compared with OZR-HF animals (102.1±3 mg/dL and 68.4±1.54 mg/dL versus 977.4±6.4, respectively). The LZR-HF-HR group showed a reduction in plasma triglyceride levels (P<0.05) compared with the LZR-HF group (59.13±0.76 mg/dL versus 182.4±1.46 mg/dL).
      The OZR-HF group showed an increase (174.7±0.40 mg/dL) in total cholesterol level compared with the OZR-RD group (60.24±1.4 mg/dL, P<0.05), whereas the OZR-HF-LR and OZR-HF-HR groups exhibited a decrease (87.2±0.04 mg/dL; 41.75±0.63 mg/dL, respectively) (P<0.05) in total cholesterol.
      HDL levels were decreased in the OZR-HF group compared with the OZR-RD group (10.6±0.18 mg/dL versus 16.9±0.42 mg/dL, P<0.05). In contrast, the OZR-HF-LR and OZR-HF-HR groups exhibited a significant (P<0.05) elevation of HDL levels (17.3±0.1 mg/dL; 41.50±0.52 mg/dL, respectively). LZR-HF animals had lower HDL levels compared with LZR-RD animals (5.39±0.10 mg/dL versus 10.31±0.07 mg/dL). The LZR-HF-HR group exhibited a significant elevation of HDL levels (15.43±0.22 mg/dL).
      LDL levels were increased in the OZR-HF compared with the OZR-RD (11.6±0.40 mg/dL versus 7.7±0.20 mg/dL, P<0.05). Rosuvastatin in high and low doses significantly decreased (P<0.05) the LDL in OZR-HF from 11.6±0.40 mg/dL to 8.1±0.23 mg/dL and 7.29±0.24 mg/dL, respectively. Rosuvastatin also decreased (P<0.05) the LDLc in LZR fed with a high-fat diet from 9.71±0.16 mg/dL to 2.75±0.05 mg/dL.

      Effect of Rosuvastatin Treatment on Renal Function

      Table 2 shows plasma BUN and creatinine results. BUN and creatinine were highest in the OZR-HFD group (52±0.6; 1.1±0.001 mg/dL, respectively). Rosuvastatin treatment significantly (P<0.05) reduced BUN and creatinine levels in OZR (OZR-HF-LR 22±0.8 mg/dL, 0.63±0.01 mg/dL; OZR-HF-HR 24±0.6 mg/dL, 0.66±0.01 mg/dL, respectively).

      Effect of Rosuvastatin Treatment on Urinary Albumin Excretion

      Urinary albumin level is an early and sensitive marker of renal injury. The urinary albumin excretion levels increased in all OZR groups by 15 weeks of age compared with the LZR group (Figure 2). When the rats were 15 weeks old, the urinary albumin excretion levels in the OZR-HF diet increased by 1-fold (119.55±0.91 mg/d versus 62.32±0.18 mg/d, P<0.05) compared with OZR-RD. However, rosuvastatin therapy significantly (P<0.05) ameliorated the albuminuria levels in OZR (OZR-HF-LR 88.59±0.77 mg/d, OZR-HF-HR 75.01±0.37 mg/d, respectively) and in LZR treated with an HF diet and rosuvastatin (P<0.05) [Figure 2, Figure 1].
      Figure thumbnail gr2
      Figure 2(A and B) Urinary albumin excretion (UAE) at 10 weeks of treatment. Mean±SEM. *P<0.05 LZR-RD vs. OZR-RD, #P<0.05 OZR-RD vs. OZR-HF; $ P<0.05 OZR-HF vs. OZR-LR, ¥P<0.05 OZR-HF vs. OZR-HF-HR, @ P<0.05 OZR-HF-LR vs. OZR-HF-HR; §P<0.05 LZR-RD vs. LZR HF; ¶P<0.05 LZR HF vs. LZR HF-HR.

      Effect of Rosuvastatin Treatment on CRP Levels

      In the OZR-HF group, there was a significant (P<0.05) increase in plasma CRP levels (95.18±1.5 ng/mL) compared with those of the OZR-RD group (56.99±1.77 mg/mL). The OZR-HF-LR group showed a 1.4-fold decrease (P<0.05) (72.35±1.96 mg/mL) in CRP levels in the plasma compared with the OZR-RD group. However, a high dose of rosuvastatin therapy (OZR-HF-HR) ameliorated (P<0.05) the CRP in plasma (60.20±3.33 mg/mL) to baseline levels. Rosuvastatin has no effect on the CRP of LZR [Figures 3(A) and 3(B)].
      Figure thumbnail gr3
      Figure 3(A and B) C-reactive protein (CRP) at 10 weeks of treatment. Mean±SEM. *P<0.05 LZR-RD vs. OZR-RD, #P<0.05 OZR-RD vs. OZR-HF; $ P<0.05 OZR-HF vs. OZR-LR, ¥P<0.05 OZR-HF vs. OZR-HF-HR, @P<0.05 OZR-HF-LR vs. OZR-HF-HR; §P<0.05 LZR RD vs. LZR HF.

      Glomerular Histology

      Table 3 shows the average glomerular diameter area, circumference, mesangial area, and perimeter from 40 glomeruli in each animal selected at random. Results show that the low-dose rosuvastatin in OZR (OZR-LR) significantly decreased (P<0.05) the glomerular area, mesangial area, and mesangial perimeter measurements. The high-dose rosuvastatin (OZR-HF-HR) exerted a marked protective effect on the glomerular histology and showed a significant (P<0.05) decrease in all the histologic parameters studied. High-dose rosuvastatin significantly (P<0.05) decreased the mesangial area and mesangial perimeter in the LZR-HF (Table 3).
      Table 3Histological data show the glomerular diameter (GD), glomerular area (GA), glomerular circumference (GC), mesangial area (MA), and perimeter (MP) from 40 glomeruli selected at random
      ParametersOZR-RDOZR-HFOZR-HF-LROZR-HF-HRLZR-RDLZR-HFLZR-HF-HR
      Glomerular diameter (μ)8.4±0.118.6±0.10
      P<0.05 OZR-RD vs. OZR-HF.
      8.4±0.088.3±0.06
      P<0.05 OZR-HF vs. OZR-HF-HR.
      8.8±0.038.33±0.138.2±0.01
      Glomerular area (μ2)57±1.259.5±1.3
      P<0.05 OZR-RD vs. OZR-HF.
      55±1.2
      P<0.05 OZR-HF vs. OZR-HF-LR.
      55±0.08
      P<0.05 OZR-HF vs. OZR-HF-HR.
      60.5±0.4752.3±1.850.75±1.71
      Glomerular circumference (μ)26.4±0.5328±0.32
      P<0.05 OZR-RD vs. OZR-HF.
      27±0.2026.1±0.20
      P<0.05 OZR-HF vs. OZR-HF-HR.
      27.4±0.1125.60±0.325.61±0.36
      Mesangial area (μ2)0.59±0.010.89±0.01
      P<0.05 OZR-RD vs. OZR-HF.
      0.55±0.03
      P<0.05 OZR-HF vs. OZR-HF-LR.
      0.54±0.01
      P<0.05 OZR-HF vs. OZR-HF-HR.
      0.51±0.020.58±0.003
      P<0.05 LZR-RD vs. LZR-HF.
      0.53±0.002
      P<0.05 LZR-HF vs. LZR-HF-HR.
      Mesangial perimeter (μ)4.0±0.014.9±0.04
      P<0.05 OZR-RD vs. OZR-HF.
      3.3±0.12
      P<0.05 OZR-HF vs. OZR-HF-LR.
      3.6±0.03
      P<0.05 OZR-HF vs. OZR-HF-HR.
      3.3±0.024.15±0.007
      P<0.05 LZR-RD vs. LZR-HF.
      3.48±0.010
      P<0.05 LZR-HF vs. LZR-HF-HR.
      Data are expressed as mean±SEM.
      OZR, obese Zucker rat; LZR, lean Zucker rat.
      a P<0.05 OZR-RD vs. OZR-HF.
      c P<0.05 OZR-HF vs. OZR-HF-LR.
      b P<0.05 OZR-HF vs. OZR-HF-HR.
      d P<0.05 LZR-RD vs. LZR-HF.
      e P<0.05 LZR-HF vs. LZR-HF-HR.

      Effects of Rosuvastatin on Kidney Gene Expression Profile

      No statistically detectable changes were noted in the mRNA expression in LZR [Figure 4(A)]. The mRNA expression of desmin (a marker for podocyte abnormalities), ICAM-1 (a fundamental component in many immune-related processes), TGF-β, and TNF-α (markers for inflammation) was assessed by real-time RT-PCR. OZR fed with a high-fat diet showed 3.8-, 2.2-, 3.3-, and 7-fold increases in desmin, ICAM-1, TGF-beta, and TNF-alpha, respectively, in the kidney cortex of the experimental animals [Figure 4(B)]. Rosuvastatin treatment significantly (P<0.05) reduced the expression of these mRNA subunits in the kidney cortex.
      Figure thumbnail gr4
      Figure 4(A and B) RT PCR data for desmin, intercellular adhesion molecule (ICAM)-1, transforming growth factor (TGF)-β, and tumor necrosis factor (TNF)-α at 10 weeks of rosuvastatin treatment in obese Zucker rats and age-matched lean controls. Mean±SEM. #P<0.05 OZR-RD vs. OZR-HF; $ P<0.05 OZR-HF vs. OZR-HF-LR, ¥P<0.05 OZR-HF vs. OZR-HF-HR, @ P<0.05 OZR-HF-LR vs. OZR-HF-HR.

      Immunofluorescence Detection of Desmin

      Immunofluorescence studies indicated the absence of desmin in LZR-RD [Figure 1 (A)] and OZR-RD [Figure 1(D)] and normal glomerular ultrastructure. OZR-HF animals showed a pronounced expression of desmin in the glomeruli [Figure 1(E)]. Interestingly, treatment with rosuvastatin significantly attenuated desmin expression in a dose-dependent manner [Figures 1(F) and 1(G)]. LZR-HF [Figure 1(B)] animals showed a slight increase in the expression of desmin compared with LZR-RD [Figure 1(A)] or OZR-RD [Figure 1(D)].

      DISCUSSION

      The development of hyperlipidemia in OZR occurs very early in life,
      • Iida M.
      • Murakami T.
      • Ishida K.
      • et al.
      Substitution at codon 269 (glutamine –> proline) of the leptin receptor (OB-R) cDNA is the only mutation found in the Zucker fatty (fa/fa) rat.
      • Kasiske B.L.
      • O’Donnell M.P.
      • Keane W.F.
      The Zucker rat model of obesity, insulin resistance, hyperlipidemia, and renal injury.
      and this hyperlipidemia may be an important factor in the development of obesity, microalbuminuria, and renal injury.
      • Magil A.B.
      Tubulointerstitial lesions in young Zucker rats.
      Previous studies have shown that OZR develop glomerular hypertrophy and mesangial expansion at the age of 3 months
      • Kasiske B.L.
      • Cleary M.P.
      • O’Donnell M.P.
      • et al.
      Effects of genetic obesity on renal structure and function in the Zucker rat.
      and albuminuria around the age of 14 weeks.
      • Osmond J.M.
      • Mintz J.D.
      • Dalton B.
      • et al.
      Obesity increases blood pressure, cerebral vascular remodeling, and severity of stroke in the Zucker rat.
      The current experiment uses an atherogenic diet high in saturated fats and cholesterol,
      • Vaskonen T.
      • Mervaala E.
      • Krogerus L.
      • et al.
      Supplementation of plant sterols and minerals benefits obese Zucker rats fed an atherogenic diet.
      which may decrease the activity and number of LDL liver receptors to induce an early serum profile characterized by an increase in triglycerides and LDL cholesterol and a decrease in HDL cholesterol, a pattern that resembles the human type of lipid alterations of MS.
      The main findings of this study were the positive effects of rosuvastatin, initiated at the age of 10 weeks, on dyslipidemia, insulin, desmin, and inflammatory molecule levels. Rosuvastatin also significantly decreased SBP, BUN, creatinine clearance, and microalbuminuria. The histologic impact of these changes on the kidneys was impressive. The low dose of rosuvastatin significantly decreased mesangial expansion, and the high dose exerted a marked protective effect on the development of both glomerular hypertrophy and mesangial expansion. Rosuvastatin also attenuated the inflammatory expression in kidney cortex.
      Hyperlipidemia in OZR, like in human subjects with MS, is characterized by an increase in triglycerides.
      • Kasiske B.L.
      • O’Donnell M.P.
      • Keane W.F.
      The Zucker rat model of obesity, insulin resistance, hyperlipidemia, and renal injury.
      • Bagby S.P.
      Obesity-initiated metabolic syndrome and the kidney: a recipe for chronic kidney disease?.
      Previous studies have shown that lipotoxicity and the excess of intracellular fatty acids induce the production of reactive intermediates, such as fatty acids, acetyl CoA, diglycerol, and ceramide, that are cytotoxic through cell apoptosis and organ damage.
      • Unger R.H.
      Minireview: weapons of lean body mass destruction: the role of ectopic lipids in the metabolic syndrome.
      • Bagby S.P.
      Obesity-initiated metabolic syndrome and the kidney: a recipe for chronic kidney disease?.
      In the presence of intraglomerular hypertension and hyperfiltration, the mesangial cell in obesity can be at particular risk for exposure to the circulating FFA: this may be an important linkage between the presence of microalbuminuria and renal injury.
      • Vaziri N.D.
      Dyslipidemia of chronic renal failure: the nature, mechanisms, and potential consequences.
      A previous study with obese subjects indicated that obesity increases renal blood flow
      • Reisin E.
      • Messerli F.G.
      • Ventura H.O.
      • et al.
      Renal haemodynamic studies in obesity hypertension.
      ;other investigators have described glomerular hyperfusion and hyperfiltration,
      • Chagnac A.
      • Weinstein T.
      • Korzets A.
      • et al.
      Glomerular hemodynamics in severe obesity.
      • Hall J.E.
      Mechanisms of abnormal renal sodium handling in obesity hypertension.
      changes that may cause glomerulomegaly and glomerulosclerosis.
      • Tran H.A.
      Obesity-related glomerulopathy.
      Animal studies in obese models have shown an increase in interstitial hydrostatic pressure that induces a decreased medullary flow and tubular compression.
      • Hall J.E.
      • Kuo J.J.
      • da Silva A.A.
      • et al.
      Obesity-associated hypertension and kidney disease.
      The concomitant slow tubular flow increases fractional tubular reabsorption. The consequence of the increased sodium chloride reabsorption is a reduced delivery of sodium chloride to the macula densa.
      • Hall J.E.
      • Kuo J.J.
      • da Silva A.A.
      • et al.
      Obesity-associated hypertension and kidney disease.
      • Hall J.E.
      Louis K. Dhal Memorial Lecture. Renal and cardiovascular mechanisms of hypertension in obesity.
      These changes originate a feedback-mediated renal vascular dilatation, increased glomerular filtration rate, and stimulation of rapid-acting insulin analogues.
      • Hall J.E.
      • Kuo J.J.
      • da Silva A.A.
      • et al.
      Obesity-associated hypertension and kidney disease.
      The glomerular hyperfiltration induced by the previously mentioned hemodynamic changes will cause proteinuria and more renal injury.
      • Hall J.E.
      • Kuo J.J.
      • da Silva A.A.
      • et al.
      Obesity-associated hypertension and kidney disease.
      • Reisin E.
      Obesity and the kidney connection.
      Other mechanisms that may be, in part, the cause of the previously described glomerular derangement could be the presence of systemic chronic inflammation,
      • Zhang R.
      • Liao J.
      • Morse S.
      • et al.
      Kidney disease and the metabolic syndrome.
      insulin resistance,
      • Aneja A.
      • El-Atat F.
      • McFarlane S.I.
      • et al.
      Hypertension and obesity.
      and leptin resistance.
      • Sowers J.R.
      Insulin resistance and hypertension.
      The presence of lipids in renal cells induce a low-grade chronic inflammatory condition that contributes to endothelial dysfunction and renal injury.
      • Zhang R.
      • Liao J.
      • Morse S.
      • et al.
      Kidney disease and the metabolic syndrome.
      The infiltration of adipocytes and macrophages to the fat tissue cause the secretion of hormones and cytokines that induce leptin and insulin resistance.
      • Zhang R.
      • Liao J.
      • Morse S.
      • et al.
      Kidney disease and the metabolic syndrome.
      • Sowers J.R.
      Insulin resistance and hypertension.
      The increased expression of leptin seems to be responsible for the kidney damage described in animal models and humans,
      • Aneja A.
      • El-Atat F.
      • McFarlane S.I.
      • et al.
      Hypertension and obesity.
      and intravenous infusion of leptin for 3 weeks in normal rats induces proteinuria and glomerulosclerosis.
      • Wolf G.
      • Chen S.
      • Han D.C.
      • et al.
      Leptin and renal disease.
      Hyperinsulinemia in rats has induced hypertension results that apparently were not mimicked in humans
      • Aneja A.
      • El-Atat F.
      • McFarlane S.I.
      • et al.
      Hypertension and obesity.
      ; however, insulin increases renal sodium absorption, which, in turn, mediates glomerular hyperfiltration and increased filtration rates. These changes may be responsible for the presence of proteinuria and glomerular damage.
      • Aneja A.
      • El-Atat F.
      • McFarlane S.I.
      • et al.
      Hypertension and obesity.
      Statins act through the inhibition of HMG-CoA reductase and inhibit the cholesterol synthesis that induces a decrease of intermediate and very-low LDL cholesterol levels.
      • Guerin M.
      • Egger P.
      • Le Goff W.
      • et al.
      Atorvastatin reduces postprandial accumulation and cholesteryl ester transfer protein-mediated remodeling of triglyceride-rich lipoprotein subspecies in type IIb hyperlipidemia.
      Statins have also been effective in decreasing insulin resistance, vascular inflammation, and arterial stiffness.
      • Guerin M.
      • Egger P.
      • Le Goff W.
      • et al.
      Atorvastatin reduces postprandial accumulation and cholesteryl ester transfer protein-mediated remodeling of triglyceride-rich lipoprotein subspecies in type IIb hyperlipidemia.
      All these changes improve the endothelial function and may increase the arterial vasodilatation.
      • Demetriou D.
      • Shabpar A.
      • Bohmig G.
      • et al.
      Beneficial effects of atorvastatin in the treatment of hyperlipidemia after renal transplantation.
      We saw significant decreases in gene and protein expression of desmin and gene expression of ICAM-1, TGF-β, and TNF-α. Desmin expression in most rat strains is limited to mesangial cells; podocyte desmin expression results from injury
      • Johnson R.
      • Iida H.
      • Alpers C.E.
      • et al.
      Expression of smooth muscle cell phenotype by rat mesangial cells in immune complex nephritis. Alpha-smooth muscle actin is a marker of mesangial cell proliferation.
      ; therefore, the dramatic increases in desmin expression, paired with the increases in ICAM-1, TGF-β, and TNF-α, indicate glomerular injury. Some of the aforementioned effects of statins may be responsible for the decreases in expression of the above-mentioned molecules, which may contribute to the beneficial effects of rosuvastatin on the kidneys of OZR.
      The effect of statins on blood pressure is still controversial.
      • Loch D.
      • Levick S.
      • Hoey A.
      • et al.
      Rosuvastatin attenuates hypertension-induced cardiovascular remodeling without affecting blood pressure in DOCA-salt hypertensive rats.
      • Sarafidis P.A.
      • Kanaki A.I.
      • Lasaridis A.N.
      Statins and blood pressure: is there an effect or not?.
      In spontaneously hypertensive rats, the use of statins prevents the development of hypertension.
      • Strazzullo P.
      • Kerry S.M.
      • Barbato A.
      • et al.
      Do statins reduce blood pressure?: a meta-analysis of randomized, controlled trials.
      In a recent meta-analysis of randomized control studies in humans, the authors concluded that statins induce a favorable effect on blood pressure, particularly SBP, with a longer positive effect in individuals with elevated blood pressure.
      • Loch D.
      • Levick S.
      • Hoey A.
      • et al.
      Rosuvastatin attenuates hypertension-induced cardiovascular remodeling without affecting blood pressure in DOCA-salt hypertensive rats.
      Human studies have been controversial regarding the protective effect of lipid-lowering therapy on the loss of renal function and kidney injury. The analysis of data obtained from a large population of hyperlipidemic patients has shown that the treatment with HMG-CoA reductase inhibitors lowered serum creatinine and increased the renal glomerular filtration rate.
      • Vidt D.G.
      • Harris S.
      • McTaggart F.
      • et al.
      Effect of short-term rosuvastatin treatment on estimated glomerular filtration rate.
      A recently published study, however, with more than 10,000 participants in the Antihypertensive and Lipid Lowering Treatment to Prevent Heart Attack Trial has shown that pravastatin was not superior to usual care in preventing clinical renal outcomes.
      • Rahman M.
      • Baimbridge C.
      • Davis B.R.
      • et al.
      Progression of kidney disease in moderately hypercholesterolemic, hypertensive patients randomized to pravastatin versus usual care: a report from the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT).
      A meta-analysis of 15 studies on the effects of statins on albuminuria has shown that statins may have a beneficial effect on proteinuria or albuminuria, but the study concluded that larger studies are needed to prove that this effect may reduce cardiovascular or end-stage renal disease.
      • Douglas K.
      • O’Malley P.G.
      • Jackson J.L.
      Meta-analysis: the effect of statins on albuminuria.
      Animal studies have proven that spontaneously hypertensive rats treated with rosuvastatin showed a renoprotective effect that was independent of the changes in blood pressure and plasma lipid levels, suggesting that statins may be useful in preventing inflammation and fibrosis in these animal models.
      • Gianella A.
      • Nobili E.
      • Abbate M.
      • et al.
      Rosuvastatin treatment prevents progressive kidney inflammation and fibrosis in stroke-prone rats.
      Rosuvastatin is the statin with the most potent lipid-lowering capacity.
      • Bianchi S.
      • Bigazzi R.
      • Caiazza A.
      • et al.
      A controlled, prospective study of the effects of atorvastatin on proteinuria and progression of kidney disease.
      High doses of rosuvastatin have induced proteinuria and hematuria. However, rosuvastatin used at the usual prescribed doses produces no deterioration of kidney function and a significant increase in the excretion of alpha 1 microglobulin, a low-molecular-weight protein of proximal tubular origin.
      • Kostapanos M.S.
      • Milionis H.J.
      • Gazi I.
      • et al.
      Rosuvastatin increases alpha-1 microglobulin urinary excretion in patients with primary dyslipidemia.
      The absence of alterations in the fractional excretion of electrolytes and uric acid in the same experiment was used to justify the lack of proximal tubular damage, and the increase in alpha-1-microglobulin urinary excretion was attributed to the effect of the inhibition of HMG-CoA reductase.
      • Kostapanos M.S.
      • Milionis H.J.
      • Gazi I.
      • et al.
      Rosuvastatin increases alpha-1 microglobulin urinary excretion in patients with primary dyslipidemia.
      It is well known that the effects of statins are pleiotropic in nature. Several of the documented effects of this drug class may apply to the results from this study. First, the main mechanism of action of statins is to inhibit HMG-CoA reductase, the rate-limiting enzyme in the synthesis of cholesterol in the liver through the mevalonate pathway.
      • Campese V.M.
      • Park J.
      HMG-CoA reductase inhibitors and the kidney.
      Mevalonate is a product of HMG-CoA reductase, thus as less mevalonate is produced, serum levels of LDLc decline. Second, mevalonate is also a precursor for isoprenoids,
      • Pierre-Paul D.
      • Gahtan V.
      Noncholesterol-lowering effects of statins.
      which, after posttranslational modification, are required for other proteins to fulfill their cellular functions. Two of these isoprenoids are specifically blocked by statins; these isoprenoids are also involved in signaling through proteins such as Rac, Ras, G-proteins, and Rho.
      • Pierre-Paul D.
      • Gahtan V.
      Noncholesterol-lowering effects of statins.
      The blockade of this signaling ultimately results in decreased activation of transcription factors and nuclear signal transduction and decreased cell proliferation, thereby resulting in an antiinflammatory effect. Finally, statins prevent lipid oxidation, and therefore oxidative stress.
      • Campese V.M.
      • Park J.
      HMG-CoA reductase inhibitors and the kidney.
      These drugs also increase nitric oxide availability. These effects, in addition to the lipid-lowering effects of statins, may have led to some of the benefits seen in this study; however, more research is needed to determine the exact nature of the positive results seen.
      The alterations in SBP seen in this study may have also contributed to the renal effects founded. In addition, the alterations could also be due to the presence of hemodynamic abnormalities in the untreated obese rat that are not seen in the statin-treated animals. However, more research is required to confirm this hypothesis because some studies suggest that the effects of statins are independent of blood pressure effects,
      • Whaley-Connell A.
      • Habibi J.
      • Nistala R.
      • et al.
      Attenuation of NADPH oxidase activation and glomerular filtration barrier remodeling with statin treatment.
      • Sironi L.
      • Gianazza E.
      • Gelosa P.
      • et al.
      Rosuvastatin, but not Simvastatin, provides end-organ protection in stroke-prone rats by antiinflammatory effects.
      whereas others suggest the opposite.
      • Loch D.
      • Levick S.
      • Hoey A.
      • et al.
      Rosuvastatin attenuates hypertension-induced cardiovascular remodeling without affecting blood pressure in DOCA-salt hypertensive rats.
      • Susic D.
      • Varagic J.
      • Ahn J.
      • et al.
      Beneficial pleiotropic vascular effects of rosuvastatin in two hypertensive models.
      In addition, the alterations could also be due to the presence of hemodynamic abnormalities in the untreated obese rat that are not seen in the statin-treated animals. Further, the dramatic decrease in triglycerides and other metabolic inflammatory alterations may explain the decrease in SBP, and all these changes together have shown a positive effect on kidney function and glomerular injury.
      Our study was not designed to elucidate the metabolic or functional alteration that induced hypertension and kidney injury in OZR fed with atherogenic diet or to learn about the specific interaction between statins and the mechanism considered important in the pathophysiology of the MS. However, the treatment with statin in this experiment proved the importance of an early-management approach for the MS in animal model that resembles the human characteristics of the MS.

      ACKNOWLEDGMENTS

      This work was in an advanced stage of completion when hurricane Katrina struck the city of New Orleans. The LSU Health Sciences Center (LSUHSC), located in the downtown area, suffered flooding and loss of power, and we lost all the samples collected from the completed experiments. Within days after the storm, the Section of Nephrology and Hypertension established a base of operation for our clinical, teaching, and research activities in Baton Rouge and Lafayette, Louisiana. With the help of colleagues at other institutions, we were able to restart and complete this research work. We thank Dr. Joseph Francis, his team of collaborators, and Dr. Xuejiao Hu for their contributions to the study and for opening their laboratories to the LSUHSC nephrology team. We also thank Sherry Ring for her technical help, Michelle Holt, M.Ed., for her excellent editorial support, and Michael T. Kearney for his valuable assistance with the statistical analysis of data.

      REFERENCES

        • Reisin E.
        • Alpert M.A.
        Definition of the metabolic syndrome: current proposals and controversies.
        Am J Med Sci. 2005; 330: 269-272
        • Iida M.
        • Murakami T.
        • Ishida K.
        • et al.
        Substitution at codon 269 (glutamine –> proline) of the leptin receptor (OB-R) cDNA is the only mutation found in the Zucker fatty (fa/fa) rat.
        Biochem Biophys Res Commun. 1996; 224: 597-604
        • Kasiske B.L.
        • O’Donnell M.P.
        • Keane W.F.
        The Zucker rat model of obesity, insulin resistance, hyperlipidemia, and renal injury.
        Hypertension. 1992; 19: I110-I115
        • Coimbra T.M.
        • Janssen U.
        • Grone H.J.
        • et al.
        Early events leading to renal injury in obese Zucker (fatty) rats with type II diabetes.
        Kidney Int. 2000; 57: 167-182
        • Vaskonen T.
        • Mervaala E.
        • Krogerus L.
        • et al.
        Supplementation of plant sterols and minerals benefits obese Zucker rats fed an atherogenic diet.
        J Nutr. 2002; 132: 231-237
        • Richards R.J.
        • Porter J.R.
        • Inserra F.
        • et al.
        Effects of dehydroepiandrosterone and quinapril on nephropathy in obese Zucker rats.
        Kidney Int. 2001; : 5937-5943
        • O’Donnell M.P.
        • Kasiske B.L.
        • Kim Y.
        • et al.
        Lovastatin retards the progression of established glomerular disease in obese Zucker rats.
        Am J Kidney Dis. 1993; 22: 83-89
        • Kasiske B.L.
        • Cleary M.P.
        • O’Donnell M.P.
        • et al.
        Effects of genetic obesity on renal structure and function in the Zucker rat.
        J Lab Clin Med. 1985; 106: 598-604
        • Vasselli J.R.
        Patterns of hyperphagia in the Zucker obese rat: a role for fat cell size and number?.
        Brain Res Bull. 1985; 14: 633-641
        • Alemzadeh R.
        • Fledelius C.
        • Bodvarsdottir T.
        • et al.
        Attenuation of hyperinsulinemia by NN414, a SUR1/Kir6.2 selective K-adenosine triphosphate channel opener, improves glucose tolerance and lipid profile in obese Zucker rats.
        Metabolism. 2004; 53: 441-447
        • Unger R.H.
        Minireview: weapons of lean body mass destruction: the role of ectopic lipids in the metabolic syndrome.
        Endocrinology. 2003; 144: 5159-5165
        • Khaleduzzaman M.
        • Francis J.
        • Corbin M.E.
        • et al.
        Infection of cardiomyocytes and induction of left ventricle dysfunction by neurovirulent polytropic murine retrovirus.
        J Virol. 2007; 81: 12307-12315
        • Osmond J.M.
        • Mintz J.D.
        • Dalton B.
        • et al.
        Obesity increases blood pressure, cerebral vascular remodeling, and severity of stroke in the Zucker rat.
        Hypertension. 2009; 53: 381-386
        • Magil A.B.
        Tubulointerstitial lesions in young Zucker rats.
        Am J Kidney Dis. 1995; 25: 478-485
        • Bagby S.P.
        Obesity-initiated metabolic syndrome and the kidney: a recipe for chronic kidney disease?.
        J Am Soc Nephrol. 2004; 15: 2775-2791
        • Vaziri N.D.
        Dyslipidemia of chronic renal failure: the nature, mechanisms, and potential consequences.
        Am J Physiol Renal Physiol. 2006; 290: F262-F272
        • Reisin E.
        • Messerli F.G.
        • Ventura H.O.
        • et al.
        Renal haemodynamic studies in obesity hypertension.
        J Hypertens. 1987; 5: 397-400
        • Chagnac A.
        • Weinstein T.
        • Korzets A.
        • et al.
        Glomerular hemodynamics in severe obesity.
        Am J Physiol Renal Physiol. 2000; 278: F817-F822
        • Hall J.E.
        Mechanisms of abnormal renal sodium handling in obesity hypertension.
        Am J Hypertens. 1997; 10: 49S-55
        • Tran H.A.
        Obesity-related glomerulopathy.
        J Clin Endocrinol Metab. 2004; 89: 6358
        • Hall J.E.
        • Kuo J.J.
        • da Silva A.A.
        • et al.
        Obesity-associated hypertension and kidney disease.
        Curr Opin Nephrol Hypertens. 2003; 12: 195-200
        • Hall J.E.
        Louis K. Dhal Memorial Lecture. Renal and cardiovascular mechanisms of hypertension in obesity.
        Hypertension. 1994; 23: 381-394
        • Reisin E.
        Obesity and the kidney connection.
        Am J Kidney Dis. 2001; 38: 1129-1134
        • Zhang R.
        • Liao J.
        • Morse S.
        • et al.
        Kidney disease and the metabolic syndrome.
        Am J Med Sci. 2005; 330: 319-325
        • Aneja A.
        • El-Atat F.
        • McFarlane S.I.
        • et al.
        Hypertension and obesity.
        Recent Prog Horm Res. 2004; 59: 169-205
        • Sowers J.R.
        Insulin resistance and hypertension.
        Am J Physiol Heart Circ Physiol. 2004; 286: H1597-602
        • Wolf G.
        • Chen S.
        • Han D.C.
        • et al.
        Leptin and renal disease.
        Am J Kidney Dis. 2002; 39: 1-11
        • Guerin M.
        • Egger P.
        • Le Goff W.
        • et al.
        Atorvastatin reduces postprandial accumulation and cholesteryl ester transfer protein-mediated remodeling of triglyceride-rich lipoprotein subspecies in type IIb hyperlipidemia.
        J Clin Endocrinol Metab. 2002; 87: 4991-5000
        • Demetriou D.
        • Shabpar A.
        • Bohmig G.
        • et al.
        Beneficial effects of atorvastatin in the treatment of hyperlipidemia after renal transplantation.
        Wien Klin Wochenschr. 2000; 112: 358-361
        • Johnson R.
        • Iida H.
        • Alpers C.E.
        • et al.
        Expression of smooth muscle cell phenotype by rat mesangial cells in immune complex nephritis. Alpha-smooth muscle actin is a marker of mesangial cell proliferation.
        J Clin Invest. 1991; 87: 847-858
        • Loch D.
        • Levick S.
        • Hoey A.
        • et al.
        Rosuvastatin attenuates hypertension-induced cardiovascular remodeling without affecting blood pressure in DOCA-salt hypertensive rats.
        J Cardiovasc Pharmacol. 2006; 47: 396-404
        • Sarafidis P.A.
        • Kanaki A.I.
        • Lasaridis A.N.
        Statins and blood pressure: is there an effect or not?.
        J Clin Hypertens (Greenwich). 2007; 9: 460-467
        • Strazzullo P.
        • Kerry S.M.
        • Barbato A.
        • et al.
        Do statins reduce blood pressure?: a meta-analysis of randomized, controlled trials.
        Hypertension. 2007; 49: 792-798
        • Vidt D.G.
        • Harris S.
        • McTaggart F.
        • et al.
        Effect of short-term rosuvastatin treatment on estimated glomerular filtration rate.
        Am J Cardiol. 2006; 97: 1602-1606
        • Rahman M.
        • Baimbridge C.
        • Davis B.R.
        • et al.
        Progression of kidney disease in moderately hypercholesterolemic, hypertensive patients randomized to pravastatin versus usual care: a report from the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT).
        Am J Kidney Dis. 2008; 52: 412-424
        • Douglas K.
        • O’Malley P.G.
        • Jackson J.L.
        Meta-analysis: the effect of statins on albuminuria.
        Ann Intern Med. 2006; 145: 117-124
        • Gianella A.
        • Nobili E.
        • Abbate M.
        • et al.
        Rosuvastatin treatment prevents progressive kidney inflammation and fibrosis in stroke-prone rats.
        Am J Pathol. 2007; 170: 1165-1177
        • Bianchi S.
        • Bigazzi R.
        • Caiazza A.
        • et al.
        A controlled, prospective study of the effects of atorvastatin on proteinuria and progression of kidney disease.
        Am J Kidney Dis. 2003; 41: 565-570
        • Kostapanos M.S.
        • Milionis H.J.
        • Gazi I.
        • et al.
        Rosuvastatin increases alpha-1 microglobulin urinary excretion in patients with primary dyslipidemia.
        J Clin Pharmacol. 2006; 46: 1337-1343
        • Campese V.M.
        • Park J.
        HMG-CoA reductase inhibitors and the kidney.
        Kidney Int. 2007; 71: 1215-1222
        • Pierre-Paul D.
        • Gahtan V.
        Noncholesterol-lowering effects of statins.
        Vasc Endovascular Surg. 2003; 37: 301-313
        • Whaley-Connell A.
        • Habibi J.
        • Nistala R.
        • et al.
        Attenuation of NADPH oxidase activation and glomerular filtration barrier remodeling with statin treatment.
        Hypertension. 2008; 51: 474-480
        • Sironi L.
        • Gianazza E.
        • Gelosa P.
        • et al.
        Rosuvastatin, but not Simvastatin, provides end-organ protection in stroke-prone rats by antiinflammatory effects.
        Arterioscler Thromb Vasc Biol. 2005; 25: 598-603
        • Susic D.
        • Varagic J.
        • Ahn J.
        • et al.
        Beneficial pleiotropic vascular effects of rosuvastatin in two hypertensive models.
        J Am Coll Cardiol. 2003; 42: 1091-1097